高清一道本无吗dⅤd在线播放,快猫记录世界记录你a.pk

> Bulletin Board

After several months of hard work, our company's website was successfully revised, a new business license was submitted, and the website's procedures were imperfect. The website currancare.com successfully operated for 17 years. This is the first generation of German The website is very valuable, earlier than Jack Ma's website, welcome to watch. Zhou Chengming, 13501072627, 2017, 11, 05

The second edition of Licorice by Zhou Chengming was officially published in 2017. The book is a total of 520,000 words. It is prefaced by Dr. Qiu Shengxiang, a well-known American natural medicinal chemist and an academician of the Chinese Academy of Sciences. It is a very professional monograph on licorice. Welcome to Xinhua Bookstore purchase. Zhou Chengming, 2017, April 2

Law of the People's Republic of China on Traditional Chinese Medicine was signed by President Xi on December 25, 2016

On December 25, 2016, President Xi signed Decree No. 59, which formally legislated the Chinese Medicine Law of the People's Republic of China.

Warmly celebrate the State Council issued a document to cancel GAP certification! 20160216

After several ups and downs, Beijing Shizhen Chinese Herbal Technology Co., Ltd. was not intimidated by the difficulties and finally ushered in the 20th anniversary celebration day. We would like to thank all our friends and customers who have supported us and wish you success! Zhou Chengming, 20150530,13501072627

After 7 years of hard work, the price trend of 80 Chinese herbal medicines in recent years has been increased on the basis of the second edition. Comrades in the editing group Zhou Chengming, Jin Guangqian, Zhang Chengwen, Xu Xiaoqin, and Chen Zhenhong have reached the cutting edge of the industry after 20 years of hard work. The third edition of 80 kinds of Chinese herbal medicine cultivation and marketing was published. Fortunately, everyone is welcome to buy at Xinhua Bookstore.

The great work "Licorice" completed by Zhou Chengming is about to be sold out. Readers are advised to buy from Xinhua Bookstore. Zhou Chengming, 2013,09,24,13501072627

Home- > Research Information
Breeding of excellent strains of Ural licorice (Ⅰ)
Publisher: admin Time: 2009/4/17 16:21:53 Read: Times


Study on Breeding of Ural Licorice Fine Lines ( )
——AFLP analysis of genetic basis of licorice from four sources
Zhou Chengming 1   Xu Bin1 , 2 Zhang Jintun2, Gao Wenyuan3
(1. Beijing Shizhen Chinese Herbal Medicine Technology Co., Ltd., Beijing 102609; 2. College of Life Science, Beijing Normal University, Beijing 100875; 3. School of Pharmaceutical Science and Technology, Tianjin University, Tianjin 300072)
Abstract: Amplified fragment length polymorphism (AFLP) marker technology was used to analyze the genetic basis of new cultivars of Ural licorice "Minqin 1", "Kashi 1", and conventional cultivated lines Inner Mongolia Ural and Glycyrrhiza uralensis. The UPGMA cluster was divided into four groups, and the fingerprints showed that the number of specific bands of “Minqin 1” and “Kashi 1” were 6 and 2 respectively. The results showed that "Minqin No. 1" and "Kashi No. 1" formed a unique genetic composition and could be used as excellent cultivation lines of Ural licorice.
Key words: Ural licorice; Fine breed selection; AFLP; Fingerprint
Study on Selective Breeding of   Glycyrrhiza uralensis   ( )
—— AFLP analysis for   Glycyrrhiza
ZHOU Cheng-ming 1 XU Bin 1 , 2   ZHANG Jin-tun 2 GAO Wen-yuan 3
(1. Beijing Shizhen herbal medicine technology Ltd., Beijing 102609, China; 2. College of Life Science of Beijing Normal University, Beijing 100875, China; 3. The College of Pharmaceutical Science and Technology, Tianjin University, Tianjin 300072, China)
Abstract : AFLP was used to evaluate the genetic polymorphism of new breed of   Glycyrrhiza uralensis   “Minqin No.1”, “Kashi No.1”, usual cultivar Nei Mongglo and   Glycyrrhiza inflata   Bat. Cluster results showed that all the populations studied were clustered into 4 groups, and fingerprinting showed the peculiar boot of   the 2 new breeds were 6 and 2. The results showed that   "Minqin No.1", "Kashi No.1" have inimitable gene structure, and should be used as new breed.
Key words:   Glycyrrhiza uralensis;   selective breeding;   AFLP; DNA fingerprinting
Leguminosae Glycyrrhiza   There are three kinds of licorice in the Linn) plant, namely Ural licorice, licorice, and licorice [1] . At present, only Ural licorice has been introduced for large-scale cultivation, and the annual output has reached 10,000 tons, which is well sold in domestic and foreign markets. However, currently the cultivated licorice product has the problems of low yield per unit area and low glycyrrhizic acid content. Many cultivation experts have conducted a series of studies on cultivation techniques [2 , 3 , 4] , but this problem has not been solved well. The main problem is that One of the reasons is that at present, no breeding lines with excellent agronomic traits and quality can be promoted in cultivation. We have been conducting research on the selection of excellent Ural licorice strains since 2001. A new Ural licorice cultivation line with excellent traits has been bred in Minqin, Gansu Province, named "Minqin No. 1". Its excellent traits are resistance to plant stress. Strong, overwintering buds are large, plant type is good, cultivated three-year-old plants bloom and seed more, main roots are long, straight and bifurcated, root diameter is strong, cultivated three-year-old glycyrrhizic acid content reaches more than 3%, single plant The fresh weight averaged 100 grams, and the root fresh weight per mu (667 m 2 ) reached 2,500 kg, which was about 1,000 kg higher than that of the conventional cultivated line Inner Mongolia Ural licorice. It was expanded by 100 hectares in 2005. In 2004, we also bred a new excellent cultivated line in Kashgar, Xinjiang, named "Kash No. 1", which has now expanded 200 hectares.
AFLP amplified fragment length polymorphism (AFLP) combines the advantages of RFLP and PCR [5] , which has the characteristics of high reliability and repeatability of RFLP, and at the same time the efficiency and safety of PCR And convenience [6] , repeatability is better than RAPD, and is widely used in plant genetics and breeding research.
In order to confirm whether the new cultivars of Ural licorice "Minqin 1" and "Kashi 1" are genetically different from the current conventional cultivars Inner Mongolia licorice and Glycyrrhiza uralensis, this paper applies AFLP technology to the above four sources Ural licorice Perform genetic basis analysis.
1   Materials and Methods
1.1 Materials
The materials used in the test were new seeds of the Ural licorice cultivation line "Minqin No. 1" and "Kashi No. 1", conventional Inner Mongolia Ural licorice and Glycyrrhiza inflata seeds. The seeds were collected and identified by Beijing Chengzhen Chinese Herbal Medicine Technology Co., Ltd. Zhou Chengming. Dried seeds were routinely germinated. Ten radicles of each material were taken and mixed into one sample to extract DNA tissue.
1.2 DNA Tissue Extraction
Extraction using CTAB method [7]   .
1.3 AFLP analysis
The reaction solution formulation and reaction procedure for template DNA digestion, ligation, pre-amplification and selective amplification were designed and performed by Beijing Dingguo Biological Company.
1.4 AFLP Atlas Analysis
ABI 377 sequencer was used for AFLP polymorphism analysis.
1.3 Data processing
Mark the clearly visible and reproducible bands on the electropherogram as "1" and the bands that do not appear at the same position as "0".
Generate an original matrix consisting of "1" and "0". Calculate the percentage of polymorphic sites (p): p = (k / n) × 100%, where k is the number of polymorphic sites; n is the total number of measured sites. With AFLP-SURV   1.0 (Vekemans   et al.,   2002) The software calculates the number of polymorphic loci and the percentage of polymorphic loci for each population. Using the Jaccard similarity coefficient as a parameter, NTSYSpc 2.0 (Rohlf, 1997) was used for cluster analysis of 40 Ural licorice samples using the Unweighted pair-group method with arithmetic mean (UPGMA).
2   Knot   fruit
2.1 Primer screening for AFLP analysis and its labeled polymorphisms
Eco-I labeled primers E-AAC, E-AAG, E-ACA, E-ACT, E-ACC, E-ACG, E-AGC, E-AGG (8) and Mse I labeled primers M-AA , M-AC, M-AG, M-AT, M-TA, M-TC, M-TG, M-TT (8) complete array of 64 primer combinations for screening, from which 8 spectra were selected A combination of primers with clear bands, uniform band pattern distribution, and high polymorphism yielded a total of 1025 bands, with an average of 128 primers per primer. A total of 540 polymorphic bands were amplified by 8 pairs of primers, and the percentage of polymorphic loci was 52.7%, of which 44 bands were common to 40 samples, and an average of 67.5 polymorphic bands were amplified per primer (Table 1 ).
Table 1   Eight primer combinations suitable for AFLP analysis of licorice and their amplification results
Table 2 The base sequence of 8 primer combinations for AFLP analysis; and AFLPs generated among 40 individuals using the eight combinations
Primer set
Primer combination
Primer sequence
Prime sequence (5′-3 ′)
Total number of sites
Total bands
Polymorphic loci
Polymorphic bands
Percentage of polymorphic loci
Polymorphism (%)
E-AAC / M-CAA
GACTGCGTACCAATTCAAAC
GATGAGTCCTGAGTAACAA
129
68
52.7
E-AAC / M-CAG
GACTGCGTACCAATTCAAAC
GATGAGTCCTGAGTAACAG
144
80
55.6
E-AAC / M-CTC
GACTGCGTACCAATTCAAAC
GATGAGTCCTGAGTAACTC '
137
69
50.4
E-AAG / M-CAA
GACTGCGTACCAATTCAAAG
GATGAGTCCTGAGTAACAA
111
59
53.2
E-AAG / M-CAG
GACTGCGTACCAATTCAAAG
GATGAGTCCTGAGTAACAG
143
75
52.4
E-AAG / M-CTC
GACTGCGTACCAATTCAAAG
GATGAGTCCTGAGTAACTC
138
72
52.2
E-AAG / M-CTT
GACTGCGTACCAATTCAAAG
GATGAGTCCTGAGTAACTT
113
56
49.6
E-ACT / M-CTC
GACTGCGTACCAATTCAACT
GATGAGTCCTGAGTAACTC
110
61
55.4
Total / Average
1025/128
540 / 67.5
-/ 52.7
2.2   Fingerprint construction
Among the 8 primer pairs screened, the E-AAC / M-CAG combination amplified a total of 144 bands, and the amplified DNA fragments ranged from 50bp to 450bp, of which 80 polymorphic bands were shared. With 64 bands, the percentage of polymorphic loci reached 55.6%, the highest among all primers. 8 specific bands, of which "Minqin 1" has 6 characteristic bands (74bp, 95bp, 113bp, 167bp, 258bp, 300bp). Two (89bp, 357bp); Glycyrrhiza inflata has five (98bp, 106bp, 113bp, 171bp, 184bp) specific bands compared to Inner Mongolia Ural licorice. Therefore, the primer combination has a strong ability to detect genetic variation differences between different licorice genotypes, and is used to construct fingerprints of "Minqin 1", "Kashi 1", Inner Mongolia control and Glycyrrhiza uralensis (Figure 1).
Ⅰ: Control of Ural Glycyrrhiza in Inner Mongolia; Ⅱ: Control of Glycyrrhiza inflata; Ⅲ: Kashi 1; Ⅳ: Minqin 1
Figure 1   AFLP fingerprint of glycyrrhiza uralensis from four sources based on primer combination E-AAC / M-CAG
Fig.1 AFLP fingerprinting amplified with primer E-AAC / M-CAG
2.3   Cluster analysis
Based on the data of 1025 DNA bands from four sources of licorice amplified by the above 8 pairs of primers, UPGMA clustering was performed according to the Jaccard similarity coefficient to construct a tree diagram of the relationship between the test materials (Figure 2).
It can be seen from the figure that licorice roots from four sources are grouped into two groups. Among them, "Minqin 1" was separated at 0.61; the other three samples were gathered together at 0.65. Glycyrrhiza inflata and "Kashi No. 1" were grouped into one branch at 0.67, and the Inner Mongolia control was isolated at 0.68. The results showed that the relationship between Glycyrrhiza inflata and "Kashi No. 1" was closest, and the relationship between Inner Mongolia control and Glycyrrhiza inflata and "Kashi No. 1" was closer, while "Minqin No. 1" was more closely related to the other three far.
3   discuss   s
During the growth process of plants, due to various reasons such as natural hybridization, gene mutation, and the long-term effects of harsh external environmental conditions, there will be varying degrees of genetic composition variation, and this variation is the basis for selecting new crop varieties .
1-c10: Inner Mongolia control; c11-c20: Glycyrrhiza uralensis control; c21-c30: Kashi 1; c31-c40: Minqin 1
Figure 2   Based on AFLP   Data for UPGMA of 40 licorice germplasm   Cluster graph
Fig. 2   Dendrogram illustrating the genetic relationships among 40
Glycyrrhiza L.   accessions based on UPGMA cluster analysis of AFLP data
"Minqin No. 1", "Kashi No. 1", and Glycyrrhiza inflata were collected from wild populations in Gansu, Xinjiang, and other places. During the process of introduction and cultivation and selection of excellent strains, we found that they were similar to conventional artificially cultivated strains Compared with Inner Mongolia Ural licorice, it has significant advantages in terms of yield per unit area, resistance, and product quality.
The UPGMA clustering chart showed that the four sources of licorice were divided into four groups and showed different distances. The fingerprints showed that the number of specific bands of “Minqin 1” and “Kashi 1” were 6 Article and 2. This shows that due to the long-term effects of the harsh growth environment, two different sources of Ural licorice have evolved their unique genetic structures after a long period of evolution. Therefore, we can confirm that "Minqin No. 1" and "Kashi No. 1", which have been bred for many years, can be further promoted as excellent cultivation lines of Ural licorice.
References :
[1] Pharmacopoeia of the People's Republic of China, 2005 edition: 65-68
[2] Zhou CM, Kong X F. A Study on Cultivation Technigues for   Glycyrrhiza uralensis   Fisch. In Daxing County Area, Beijing [J].   China Journal of Chinese Materia Medica , 2000, 25 (3): 140-143
[3] Zhou C M. the outline of the normative Cultivation Technigues for   Glycyrrhiza uralensis   Fisch. [J].   Research & Information on Traditional Chinese Medicine . 2003,5 (2): 25-28
[4] Zhou C M. Cultivation Technigues for   Glycyrrhiza uralensi s Fisch. [J]. Xinjiang Farmland Reclamation Science & Technology. 2006 (1): 14-15
[5] Vos P, Hogers R, Bleeker M, et al. AFLP: a new technique for DNA fingerprinting [J].   Nucleic Acids Research , 1995, 23 (21): 4407-4414
[6] Sun QL, Liang YR, Ding ZT, et al. AFLP molecular marker technique and its application to tea Genetic and breeding research [J].   Journal of Te a (Tea), 2004, 30 (4): 203-206
[7] Doyle JJ, Doyle JL, 1990. Isolation of plant DNA from fresh tissue [J].   Focus   , 12 (1): 13 -15


  • NEXT: Report on the planting of traditional Chinese medicinal materials and the market of traditional Chinese medicinal materials in the northern region (80 pictures)

  • NEXT: Study on the film-covering technology of Ural licorice covered with different sowing dates

  • 公安局备案号:京公网安备110115000260 Copyright 2009-2012 All Rights Reserved Beijing Shizhen Chinese Herbal Medicine Technology Co., Ltd. Headquarters Base Address: Ma Village, Huangliang Road, Daxing District, Beijing Tel: 010-61259631; 61259886; 13501072627 Beijing ICP: 09013129 Public Security Bureau Record Number: Beijing Public Security Equipment 110115000260